non targeting control sequence  (Addgene inc)

Journal: Life Science Alliance

Article Title: CENP-C-Mis12 complex establishes a regulatory loop through Aurora B for chromosome segregation

doi: 10.26508/lsa.202402927

Figure Lengend Snippet: (A) Strategy to generate CENP-C WT or CENP-C ∆M12BD RPE1 cells expressing mScarlet-CENP-A and GFP-H2A (see also ). (B) Schematic representation of mScarlet-CENP-A cDNA targeting into the endogenous CENP-A locus. To express mScarlet-fused CENP-A under the control of the endogenous CENP-A promoter, mScarlet-CENP-A cDNA was targeted into exon 1 by CRISPR/Cas9-mediated homologous recombination. Because the targeting constructs have puromycin resistance genes ( PuroR ) or neomycin resistance genes ( NeoR ), targeted cells were selected using these selection markers. The gRNA sequence and the position of primers for genotyping are shown. (C) Genotyping PCR and immunoblotting for mScarlet-CENP-A in mScarlet-CENP-A –introduced RPE-1 cells. Genotyping in isolated single clones was performed using the primers shown in (B). In immunoblots, CENP-A was detected by an antibody against CENP-A, and α-tubulin was probed as a loading control. (D) Schematic representation of GFP-H2A cDNA targeting into the AAVS1 locus ( PPP1R12C gene). To express GFP-fused histone H2A from the AAVS1 locus, GFP-H2A cDNA was targeted into intron 1 by CRISPR/Cas9-mediated homologous recombination. Because the targeting construct has blasticidin resistance genes ( BsR ), targeted cells were selected using the BsR marker. The gRNA sequence and the position of primers for genotyping are shown. (E) Genotyping PCR of GFP-H2A –introduced RPE-1 cells. Genotyping in an isolated single clone was performed using the primers shown in (D). (F) Schematic representation of FLAG-human CENP-C cDNA targeting into the endogenous human CENP-C locus. To express FLAG-tagged CENP-C wild-type (WT) or a Mis12C-binding domain deletion mutant (∆M12BD: ∆1-75) under the control of the endogenous CENP-C promoter, FLAG-CENP-C WT or ∆M12BD cDNA was targeted into exon 1 by CRISPR/Cas9-mediated homologous recombination. Because the targeting constructs have zeocin resistance genes ( ZeoR ) or histidinol resistance genes ( histidinol dehydrogenase : HisD ), targeted cells were selected using these selection markers. The gRNA sequence and the position of primers for genotyping are shown. (G) Genotyping PCR and immunoblotting for FLAG-CENP-C in FLAG-CENP-C –introduced RPE-1 cells. Genotyping in isolated single clones was performed using the primers shown in (F). In immunoblots, CENP-C was detected by an antibody against human CENP-C, and histone H3 was probed as a loading control. (H) Growth curve of CENP-C WT or CENP-C ∆M12BD RPE1 cells. The cell numbers were normalized to those at day 0 of each line. Error bars indicate the mean and SD. Two clones of CENP-C ∆M12BD RPE1 cells were examined.

Article Snippet: We amplified DNA fragments containing T7 promoter, gRNA target sequences (intron 1: CCAACACTATAGCTGACAAG; intron 4: AAACTGATAGAGTACAGTGG), and gRNA scaffold sequences by PCR using primers shown in Table S1 and pX330 (plasmid #42230; Addgene) ( ) as a template.

Techniques: Expressing, Control, CRISPR, Homologous Recombination, Construct, Selection, Sequencing, Western Blot, Isolation, Clone Assay, Marker, Binding Assay, Mutagenesis

Journal: Life Science Alliance

Article Title: CENP-C-Mis12 complex establishes a regulatory loop through Aurora B for chromosome segregation

doi: 10.26508/lsa.202402927

Figure Lengend Snippet: (A) Strategy to generate CENP-T WT , CENP-T ∆NBD−1 , or CENP-T ∆NBD−2 RPE1 cells (see also ). In the cells, mini-auxin-inducible degron (mAID)–tagged human CENP-T was expressed together with OsTIR1 from the AAVS locus. Because mAID-fused CENP-T is degraded upon IAA (indole-3-acetic acid) treatment, mScarlet-tagged CENP-T is only expressed from the endogenous CENP-T locus in CENP-T WT , CENP-T ∆NBD−1 , or CENP-T ∆NBD−2 RPE1 cells. (B) Schematic representation of GFP-mAID-CENP-T and OsTIR1 cDNA targeting into the AAVS1 locus ( PPP1R12C gene). To express GFP- and mAID-fused human CENP-T and OsTIR1, the expression cassette was targeted into intron 1 by CRISPR/Cas9-mediated homologous recombination. Because the targeting construct has blasticidin resistance genes ( BsR ), targeted cells were selected using the BsR marker. The gRNA sequence and the position of primers for genotyping are shown. (C) Schematic representation of mScarlet-CENP-T cDNA targeting the endogenous CENP-T locus. To express mScarlet-tagged CENP-T WT or each of the Ndc80C-binding domain mutants (∆NBD-1: ∆6-31; ∆NBD-2: ∆76-105) under the control of the endogenous CENP-T promoter, mScarlet-CENP-T WT , ∆NBD-1 , or ∆NBD-2 cDNA was targeted into exon 1 by CRISPR/Cas9-mediated homologous recombination. Because the targeting constructs have puromycin resistance genes ( PuroR ) or neomycin resistance genes ( NeoR ), targeted cells were selected using these selection markers. The gRNA sequence and the position of primers for genotyping are shown. (D) Genotyping PCR for the GFP-mAID-CENP-T/OsTIR1 expression cassette in CENP-T WT , CENP-T ∆NBD−1 , or CENP-T ∆NBD−2 RPE1 cells. Genotyping in isolated single clones was performed using the primers shown in (B). WT RPE-1 cells were used as a control. (E) Genotyping PCR for targeted mScarlet-CENP-T in CENP-T WT , CENP-T ∆NBD−1 , or CENP-T ∆NBD−2 RPE1 cells. Genotyping in isolated single clones was performed using the primers shown in (C). WT RPE-1 cells were used as a control. (F) CENP-T protein expression in CENP-T WT , CENP-T ∆NBD−1 , or CENP-T ∆NBD−2 RPE-1 cells. The cells were treated with or without IAA for 1 d, and we examined GFP-mAID-CENP-T and mScarlet-CENP-T protein expression using an antibody against CENP-T or mScarlet (RFP). α-Tubulin was probed as a loading control. (G) Schematic representation of recruitment of KMN subcomplexes onto CENP-C or CENP-T in the human cells.

Article Snippet: We amplified DNA fragments containing T7 promoter, gRNA target sequences (intron 1: CCAACACTATAGCTGACAAG; intron 4: AAACTGATAGAGTACAGTGG), and gRNA scaffold sequences by PCR using primers shown in Table S1 and pX330 (plasmid #42230; Addgene) ( ) as a template.

Techniques: Expressing, CRISPR, Homologous Recombination, Construct, Marker, Sequencing, Binding Assay, Control, Selection, Isolation, Clone Assay

Journal: Life Science Alliance

Article Title: CENP-C-Mis12 complex establishes a regulatory loop through Aurora B for chromosome segregation

doi: 10.26508/lsa.202402927

Figure Lengend Snippet: (A) Strategy to generate CENP-T ∆M12BD RPE1 cells. In the cells, mini-auxin-inducible degron (mAID)–tagged human CENP-T was expressed together with OsTIR1 from the AAVS locus. Because mAID-fused CENP-T is degraded upon IAA (indole-3-acetic acid) treatment, mScarlet-tagged CENP-T is only expressed from the endogenous CENP-T locus in CENP-T ∆M12BD RPE1 cells. (B) Schematic representation of mScarlet-CENP-T cDNA targeting the endogenous CENP-T locus. To express mScarlet-tagged Mis12C-binding domain mutant CENP-T (∆M12BD: ∆107-230) or wild-type CENP-T under the control of the endogenous CENP-T promoter, mScarlet-CENP-T cDNAs were targeted into exon 1 by CRISPR/Cas9-mediated homologous recombination. Because the targeting constructs have puromycin resistance genes ( PuroR ) or neomycin resistance genes ( NeoR ), targeted cells were selected using these selection markers. The gRNA sequence and the position of primers for genotyping are shown. (C) Genotyping PCR for targeted mScarlet-CENP-T in CENP-T ∆M12BD RPE1 cells. Genotyping in isolated single clones was performed using the primers shown in (B). WT RPE-1 cells were used as a control. (D) CENP-T protein expression in CENP-T WT or CENP-T ∆M12BD RPE-1 cells. The cells were treated with or without IAA for 2 d, and we examined GFP-mAID-CENP-T and mScarlet-CENP-T protein expression using an antibody against CENP-T or mScarlet (RFP). α-Tubulin was probed as a loading control. (E) Schematic representation of human CENP-T. Human CENP-T WT has two Ndc80C-binding regions and a Mis12-binding domain (M12BD: amino acids 107–230). The M12BD region was deleted in CENP-T ∆M12BD . (F) DSN1 localization in CENP-T WT or CENP-T ∆M12BD RPE-1 cells. DSN1 was stained with an antibody against DSN1 (green). DSN1 localization at mitotic kinetochores was examined and quantified. mScarlet-CENP-T is a kinetochore marker (CENP-T, red). DNA was stained with DAPI (blue). Scale bar, 5 μm. Mean and SD, two-tailed t test, CENP-T WT RPE-1 cells: n = 10 cells; CENP-T ∆M12BD RPE-1 cells: n = 10 cells. (G) KNL1 localization in CENP-T WT or CENP-T ∆M12BD RPE-1 cells. KNL1 was stained with an antibody against KNL1 (green). mScarlet-CENP-T is a kinetochore marker (CENP-T, red). DNA was stained with DAPI (blue). KNL1 localization at mitotic kinetochores was examined and quantified. Scale bar, 5 μm. Mean and SD, two-tailed t test, CENP-T WT RPE-1 cells: n = 10 cells; CENP-T ∆M12BD RPE-1 cells: n = 10 cells. (H) Hec1 localization in CENP-T WT or CENP-T ∆M12BD RPE-1 cells. Hec1 was stained with an antibody against Hec1 (green). Hec1 localization at mitotic kinetochores was examined and quantified. Scale bar, 5 μm. Mean and SD, two-tailed t test, CENP-T WT RPE-1 cells: n = 10 cells; CENP-T ∆M12BD RPE-1 cells: n = 10 cells. (I) Bub1 localization in CENP-T WT or CENP-T ∆M12BD RPE-1 cells. Bub1 was stained with an antibody against Bub1 (green). mScarlet-CENP-T is a kinetochore marker (CENP-T, red). DNA was stained with DAPI (blue). Scale bar, 5 μm. Bub1 signal intensities at kinetochores were quantified (mean and SD, two-tailed t test, CENP-T WT RPE-1 cells: n = 363 kinetochores from 5 cells; CENP-T ∆M12BD RPE-1 cells: n = 346 kinetochores from 5 cells). (J) H2AT120ph localization in CENP-T WT or CENP-T ∆M12BD cells. H2AT120ph was stained with an antibody against H2AT120ph (green). mScarlet-CENP-T is a kinetochore marker (CENP-T, red). DNA was stained with DAPI (blue). Scale bar, 5 μm. H2AT120ph signal intensities at kinetochore-proximal centromeres were quantified (mean and SD, two-tailed t test, CENP-T WT RPE-1 cells: n = 297 kinetochores from 5 cells; CENP-T ∆M12BD RPE-1 cells: n = 366 kinetochores from 5 cells). (K) Aurora B localization in CENP-T WT or CENP-T ∆M12BD RPE-1 cells. Aurora B was stained with an antibody against Aurora B (green). mScarlet-CENP-T is a kinetochore marker (CENP-T, red). DNA was stained with DAPI (blue). Scale bar, 10 μm. The insets show an enlarged single chromosome (scale bar, 1 μm). Aurora B signal intensities at inner centromeres were quantified (mean and SD, two-tailed t test, CENP-T WT RPE-1 cells: n = 186 centromeres from 5 cells; CENP-T ∆M12BD RPE-1 cells: n = 207 centromeres from 5 cells).

Article Snippet: We amplified DNA fragments containing T7 promoter, gRNA target sequences (intron 1: CCAACACTATAGCTGACAAG; intron 4: AAACTGATAGAGTACAGTGG), and gRNA scaffold sequences by PCR using primers shown in Table S1 and pX330 (plasmid #42230; Addgene) ( ) as a template.

Techniques: Binding Assay, Mutagenesis, Control, CRISPR, Homologous Recombination, Construct, Selection, Sequencing, Isolation, Clone Assay, Expressing, Staining, Marker, Two Tailed Test

Journal: Life Science Alliance

Article Title: CENP-C-Mis12 complex establishes a regulatory loop through Aurora B for chromosome segregation

doi: 10.26508/lsa.202402927

Figure Lengend Snippet: (A) Strategy to generate RPE-1 cell lines expressing DSN1 WT or DSN1 ∆BM with CENP-C WT or CENP-C ∆M12BD (CC WT /DSN1 WT , CC WT /DSN1 ∆BM , CC ∆M12BD /DSN1 WT , or CC ∆M12BD /DSN1 ∆BM RPE-1 cells). mScarlet-CENP-A was also expressed in all cell lines. The DSN1 basic motif (amino acids 91–113) was deleted in DSN1 ∆BM . (B) Schematic representation of mScarlet-DSN1 cDNA targeting the endogenous DSN1 locus. To express mScarlet-tagged DSN1 wild-type (WT) or a basic motif deletion mutant (∆BM: ∆91-113) under the control of the endogenous DSN1 promoter, mScarlet-DSN1 WT or ∆BM cDNAs were targeted into the DSN1 locus by CRISPR/Cas9-mediated homologous recombination. Because the targeting constructs have blasticidin S resistance genes ( BsR ), targeted cells were selected using the selection marker. The gRNA sequence and the position of primers for genotyping are shown. (C) Genotyping PCR and immunoblotting for CC WT /DSN1 WT , CC WT /DSN1 ∆BM , CC ∆M12BD /DSN1 WT , or CC ∆M12BD /DSN1 ∆BM RPE-1 cells. Genotyping in isolated single clones was performed using the primers shown in (B). In immunoblots, DSN1 was detected by an antibody against DSN1 or mScarlet (RFP), and α-tubulin was probed as a loading control. (D) DSN1 localization in CC WT /DSN1 WT , CC WT /DSN1 ∆BM , CC ∆M12BD /DSN1 WT , and CC ∆M12BD /DSN1 ∆BM RPE-1 cells. DSN1, a subunit of the Mis12C (green), was stained with an antibody against DSN1 (green). The mScarlet-CENP-A and mScarlet-DSN1 were used as a kinetochore marker (CENP-A/DSN1, red). DNA was stained with DAPI (blue). Scale bar, 5 μm. DSN1 signal intensities at mitotic kinetochores were quantified. A representative result from two independent experiments is shown (mean and SD, one-way ANOVA with Tukey’s multiple comparison test, CC WT /DSN1 WT RPE-1 cells: n = 10 cells; CC WT /DSN1 ∆BM RPE-1 cells: n = 10 cells; CC ∆M12BD /DSN1 WT RPE-1 cells: n = 10 cells; CC ∆M12BD /DSN1 ∆BM RPE-1 cells: n = 10 cells). (E) KNL1 localization in CC WT /DSN1 WT , CC WT /DSN1 ∆BM , CC ∆M12BD /DSN1 WT , and CC ∆M12BD /DSN1 ∆BM RPE-1 cells. KNL1 was stained with an antibody against KNL1 (green). The mScarlet-CENP-A and mScarlet-DSN1 were used as a kinetochore marker (CENP-A/DSN1, red). DNA was stained with DAPI (blue). Scale bar, 5 μm. DSN1 signal intensities at mitotic kinetochores were quantified. A representative result from two independent experiments is shown (mean and SD, one-way ANOVA with Tukey’s multiple comparison test, CC WT /DSN1 WT RPE-1 cells: n = 10 cells; CC WT /DSN1 ∆BM RPE-1 cells: n = 10 cells; CC ∆M12BD /DSN1 WT RPE-1 cells: n = 10 cells; CC ∆M12BD /DSN1 ∆BM RPE-1 cells: n = 10 cells). (F) Bub1 localization in CC WT /DSN1 WT , CC WT /DSN1 ∆BM , CC ∆M12BD /DSN1 WT , and CC ∆M12BD /DSN1 ∆BM RPE-1 cells. Bub1 was stained with an antibody against Bub1 (green). The mScarlet-CENP-A and mScarlet-DSN1 were used as a kinetochore marker (CENP-A/DSN1, red). DNA was stained with DAPI (blue). Scale bar, 5 μm. Bub1 signal intensities at mitotic kinetochores were quantified. A representative result from two independent experiments is shown (mean and SD, one-way ANOVA with Tukey’s multiple comparison test, CC WT /DSN1 WT RPE-1 cells: n = 354 kinetochores from 5 cells; CC WT /DSN1 ∆BM RPE-1 cells: n = 327 kinetochores from 5 cells; CC ∆M12BD /DSN1 WT RPE-1 cells: n = 375 kinetochores from 5 cells; CC ∆M12BD /DSN1 ∆BM RPE-1 cells: n = 386 kinetochores from 5 cells). (G) Aurora B localization in CC WT /DSN1 WT , CC WT /DSN1 ∆BM , CC ∆M12BD /DSN1 WT , and CC ∆M12BD /DSN1 ∆BM RPE-1 cells. Aurora B was stained with an antibody against Aurora B (green). The mScarlet-CENP-A and mScarlet-DSN1 were used as a kinetochore marker (CENP-A/DSN1, red). DNA was stained with DAPI (blue). Scale bar, 10 μm. The insets show an enlarged single chromosome (scale bar, 2 μm). Aurora B signal intensities at inner centromeres were quantified. A representative result from two independent experiments is shown (mean and SD, one-way ANOVA with Tukey’s multiple comparison test, CC WT /DSN1 WT RPE-1 cells: n = 228 kinetochores from 5 cells; CC WT /DSN1 ∆BM RPE-1 cells: n = 221 kinetochores from 5 cells; CC ∆M12BD /DSN1 WT RPE-1 cells: n = 215 kinetochores from 5 cells; CC ∆M12BD /DSN1 ∆BM RPE-1 cells: n = 212 kinetochores from 5 cells). (H) Aurora B localization in CC WT /DSN1 WT , CC WT /DSN1 ∆BM , CC ∆M12BD /DSN1 WT , and CC ∆M12BD /DSN1 ∆BM RPE-1 cells treated with 5-ITu for 30 min. Aurora B was stained with an antibody against Aurora B (green). The mScarlet-CENP-A and mScarlet-DSN1 were used as a kinetochore marker (CENP-A/DSN1, red). DNA was stained with DAPI (blue). Scale bar, 10 μm. The insets show enlarged chromosomes (scale bar, 2 μm). Aurora B signal intensities at the kinetochore-proximal pool were quantified. A representative result from two independent experiments is shown (mean and SD, one-way ANOVA with Tukey’s multiple comparison test, CC WT /DSN1 WT RPE-1 cells: n = 387 kinetochores from 5 cells; CC WT /DSN1 ∆BM RPE-1 cells: n = 389 kinetochores from 5 cells; CC ∆M12BD /DSN1 WT RPE-1 cells: n = 381 kinetochores from 5 cells; CC ∆M12BD /DSN1 ∆BM RPE-1 cells: n = 395 kinetochores from 5 cells).

Article Snippet: We amplified DNA fragments containing T7 promoter, gRNA target sequences (intron 1: CCAACACTATAGCTGACAAG; intron 4: AAACTGATAGAGTACAGTGG), and gRNA scaffold sequences by PCR using primers shown in Table S1 and pX330 (plasmid #42230; Addgene) ( ) as a template.

Techniques: Expressing, Mutagenesis, Control, CRISPR, Homologous Recombination, Construct, Selection, Marker, Sequencing, Western Blot, Isolation, Clone Assay, Staining, Comparison

Journal: Life Science Alliance

Article Title: CENP-C-Mis12 complex establishes a regulatory loop through Aurora B for chromosome segregation

doi: 10.26508/lsa.202402927

Figure Lengend Snippet: (A) Strategy to generate DSN1 WT or DSN1 ∆BM HeLa cell lines (see also ). (B) Schematic representation of mScarlet-DSN1 cDNA targeting the endogenous DSN1 locus. To express mScarlet-tagged DSN1 WT or a basic motif deletion mutant (∆BM: ∆91-113) under the control of the endogenous DSN1 promoter, mScarlet-DSN1 WT or ∆BM cDNAs were targeted into the DSN1 locus by CRISPR/Cas9-mediated homologous recombination. Because the targeting constructs have puromycin resistance genes ( PuroR ) or neomycin resistance genes ( NeoR ), targeted cells were selected using these selection markers. The gRNA sequence and the position of primers for genotyping are shown. (C) Genotyping PCR and immunoblotting for mScarlet-DSN1 in mScarlet-DSN1 –introduced HeLa cells. Genotyping in isolated single clones was performed using the primers shown in (B). In immunoblots, DSN1 was detected by an antibody against DSN1 or mScarlet (RFP), and α-tubulin was probed as a loading control. (D) Hec1 and KNL1 localization in DSN1 WT or DSN1 ∆BM HeLa cells. Hec1 (green) and KNL1 (cyan) were stained with antibodies against Hec1 and KNL1, respectively. mScarlet-DSN1 is a kinetochore marker (DSN1, red). DNA was stained with DAPI (blue). Scale bar, 5 μm. Hec1 or KNL1 signal intensities at mitotic kinetochores were quantified. A representative result from two independent experiments is shown (mean and SD, two-tailed t test, DSN1 WT : n = 7; DSN1 ∆BM : n = 7).

Article Snippet: We amplified DNA fragments containing T7 promoter, gRNA target sequences (intron 1: CCAACACTATAGCTGACAAG; intron 4: AAACTGATAGAGTACAGTGG), and gRNA scaffold sequences by PCR using primers shown in Table S1 and pX330 (plasmid #42230; Addgene) ( ) as a template.

Techniques: Mutagenesis, Control, CRISPR, Homologous Recombination, Construct, Selection, Sequencing, Western Blot, Isolation, Clone Assay, Staining, Marker, Two Tailed Test

Journal: bioRxiv

Article Title: Hypoxia promotes airway differentiation in the human lung epithelium

doi: 10.1101/2024.08.09.607336

Figure Lengend Snippet: (A) Diagram of HRE-ODD-GFP reporter construct and oxygen-dependent GFP turnover. (B) Microscope images of merged brightfield and GFP channels. The HRE-ODD-GFP reporter progenitors were cultured under normoxia for 6 days to form organoids, then treated with normoxia or hypoxia for 10 days without passaging. Control cells were cultured under normoxia with routine passaging. Scale bars = 600 µm. (C) The percentage of organoids containing ≥ 1 GFP + cell(s). Data shown as mean ± SD, n = 7 (normoxia), 8 (hypoxia) experimental replicates from 2 biological donors. (D) Roxadustat (FG-4592) inhibits PHD enzymes under normoxia and stabilises HIFα subunits. (E) HIF1α and HIF2α were stabilised under normoxia by Roxadustat in 4 organoid lines with β-actin as loading control. (F) Roxadustat treatment activated the HIF pathway under normoxia and recapitulated hypoxia-induced differentiation. RT-qPCR detection of organoids cultured in SRM ± Roxadustat for 30 days. Fold changes were normalised to the mean of SRM – Roxadustat (with DMSO) condition. Data shown as Log 2 (fold change), n = 6 biological donors. Statistical comparisons by two-way ANOVA with Bonferroni’s multiple comparisons test. (G) Design of targeted DamID-seq for HIF1α and HIF2α. Dam-HIFα fusion proteins are expressed at a low level due to rare translation reinitiation events. The fusion proteins methylate adenines in the GATC sequences near their DNA binding sites. (H) Global distributions of HIF1α and HIF2α binding sites relative to the Transcriptional Start Site (TSS). (I) Quantification of HIF1α and HIF2α binding signals surrounding the TSS. HIF1α and HIF2α signals were normalised to Dam-only control. (J) Gene ontology analysis of HIF1a and HIF2a common target genes. (K) Venn diagram comparing HIF1α and HIF2α target genes with highlighted gene lists. (L) Gene track views showing averaged DamID signals and consensus peaks from three biological replicates over selected HIF1α and HIF2α binding and no binding genes. Gene expression was normalised to ACTB in RT-qPCR. Significance levels: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. See also .

Article Snippet: For mutated HIF1α and HIF2α overexpression, the HIF1A and HIF2A CDS were cloned from plasmids gifted from William Kaelin (Addgene, #87261, #25956) and inserted into Tet-ON vectors with EF1a-TagRFP-2A-tet3G., For CRISPRi, the gRNA sequences targeting HIF1A , HIF2A , KLF4 , KLF5 were selected from published dataset and inserted into U6-gRNA-EF1a-EGFP-CAAX lentiviral vectors (Addgene, #167936)., For targeted DamID, the wild-type HIF1A and HIF2A CDS were inserted into DamID vectors with SFFV-mNeonGreen as upstream open reading frame.

Techniques: Construct, Microscopy, Cell Culture, Passaging, Control, Quantitative RT-PCR, Binding Assay, Gene Expression

Journal: bioRxiv

Article Title: Hypoxia promotes airway differentiation in the human lung epithelium

doi: 10.1101/2024.08.09.607336

Figure Lengend Snippet: (A) HIF1α is inhibited by CRISPRi. The dCas9-KRAB effector was tagged with DHFR and stabilised in presence of TMP (Trimethoprim) to reduce leaky expression from the Tet-on promoter. HIF1α protein levels decreased after 4-9 day knock down under hypoxia as shown by Western blot. (B) Upper panel: experimental design. The non-targeting control (NTC) or HIF1A- knock down ( HIF1A- KD) organoids were cultured under normoxia or hypoxia for 30 days. The dCas9 was induced 2 days ahead of hypoxia treatment. Lower panel: RT-qPCR results. Fold changes were normalised to the average of NTC + normoxia condition (not shown). Bars represent mean Log 2 (fold change) ± SD, n = 4 experimental replicates from 3 biological donors. 2 gRNAs tested. (C) Immunostaining of organoids with NTC or HIF1A- KD induction for 30 days showed changes in organoid shape (Ecad: E-cadherin) and differentiation (ASCL1, KRT5). Representative images from 3 organoid lines. (D) The NTC and HIF1A -KD organoids were cultured under normoxia or hypoxia for 9 days and used for bulk RNA-seq with 2 gRNAs and 3 biological donors for each condition. Heatmap showing 7309 differentially expressed genes (DEGs) (|Log2(fold change)| > 0.5, Padj < 0.05, merged from DEGs in comparisons of hypoxia + NTC vs normoxia + NTC, and hypoxia + HIF1αKD vs hypoxia + NTC) across all samples, representative genes labelled. (E) and (F) GSEA results of 9621 DEGs ( Padj < 0.05) between hypoxia and normoxia NTC organoids (E), 5904 DEGs ( Padj < 0.05) between HIF1A- KD and NTC hypoxic organoids (F). (G) Stabilised form of HIF1α was induced by Tet-On system under normoxia with GFP as control. (H) Immunostaining of organoids overexpressing GFP or HIF1α for 30 days under normoxia. Representative images of 2 organoid lines. (I) and (J) HIF1α overexpression under normoxia induced HIF pathway genes (I) and differentiation genes (J). The fold changes normalised to the average of GFP-overexpression organoids. Data shown as Log 2 (fold change), n = 3 biological donors. Scale bars=100 µm. For RT-qPCR, Gene expression was normalised to ACTB . Statistical test: two-way ANOVA with Bonferroni’s multiple comparisons test. Significance levels: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. See also .

Article Snippet: For mutated HIF1α and HIF2α overexpression, the HIF1A and HIF2A CDS were cloned from plasmids gifted from William Kaelin (Addgene, #87261, #25956) and inserted into Tet-ON vectors with EF1a-TagRFP-2A-tet3G., For CRISPRi, the gRNA sequences targeting HIF1A , HIF2A , KLF4 , KLF5 were selected from published dataset and inserted into U6-gRNA-EF1a-EGFP-CAAX lentiviral vectors (Addgene, #167936)., For targeted DamID, the wild-type HIF1A and HIF2A CDS were inserted into DamID vectors with SFFV-mNeonGreen as upstream open reading frame.

Techniques: Expressing, Knockdown, Western Blot, Control, Cell Culture, Quantitative RT-PCR, Immunostaining, RNA Sequencing, Over Expression, Gene Expression

Journal: bioRxiv

Article Title: Hypoxia promotes airway differentiation in the human lung epithelium

doi: 10.1101/2024.08.09.607336

Figure Lengend Snippet: (A) RT-qPCR control of samples used for bulk RNA-seq. NTC and HIF1A -knock down ( HIF1A- KD) organoids were cultured under normoxia or hypoxia for 9 days. Fold changes were normalised to the mean of NTC + normoxia condition. Bars represent mean Log 2 (fold change) ± SD, n = 8 experimental replicates from 4 biological donors with 2 gRNAs. For bulk RNA-seq, 6 replicates (3 biological donors with 2 gRNAs) for each condition were selected. Statistical test: two-way ANOVA with Tukey’s multiple comparisons test. (B) Heatmap of 655 DEGs related to GSEA terms enriched in hypoxia compared to normoxia NTC organoids. Every 1 in 4 genes are labelled due to space limitations. (C) Heatmap of 345 DEGs related to GSEA terms enriched in HIF1A- KD compared to NTC hypoxic organoids. Every 1 in 2 genes were labelled due to space limitations. (D) RT-qPCR of NTC and HIF1A- KD organoids cultured in airway differentiation medium (AWDM) under normoxia for 15 days. The fold changes were normalised to the mean of normoxia + SRM condition (not shown). Bars represent Log 2 (fold change) ± SD, n = 5 (NTC), 6 ( HIF1A- KD) experimental replicates from 3 biological donors with 2 gRNAs. Statistical test: two-way ANOVA with Bonferroni’s multiple comparisons test. Gene expression was normalised by ACTB in RT-qPCR. Significance levels: *p < 0.05, **p < 0.01, ***p < 0.001.

Article Snippet: For mutated HIF1α and HIF2α overexpression, the HIF1A and HIF2A CDS were cloned from plasmids gifted from William Kaelin (Addgene, #87261, #25956) and inserted into Tet-ON vectors with EF1a-TagRFP-2A-tet3G., For CRISPRi, the gRNA sequences targeting HIF1A , HIF2A , KLF4 , KLF5 were selected from published dataset and inserted into U6-gRNA-EF1a-EGFP-CAAX lentiviral vectors (Addgene, #167936)., For targeted DamID, the wild-type HIF1A and HIF2A CDS were inserted into DamID vectors with SFFV-mNeonGreen as upstream open reading frame.

Techniques: Quantitative RT-PCR, Control, RNA Sequencing, Knockdown, Cell Culture, Gene Expression

Journal: bioRxiv

Article Title: Hypoxia promotes airway differentiation in the human lung epithelium

doi: 10.1101/2024.08.09.607336

Figure Lengend Snippet: (A) and (B) KLF4 and KL5 expression level from bulk RNA-seq data (as described in ) comparing Normoxia + NTC to Hypoxia + NTC (A), or Hypoxia + NTC to Hypoxia + HIF1A -knock down (KD) (B), n = 6 (2 gRNAs and 3 donors) for each condition. Each line indicates the change of the average counts of the two gRNA replicates from the same biological donor. (C) HIF2A knock down decreased KLF4 but not KLF5 expression under hypoxia. Data shown as Log 2 (fold change), n = 5 experimental replicates from 4 biological donors. 2 gRNAs used. (D) and (E) Stabilised HIF1α and HIF2α (as described in , ) overexpression under normoxia increased KLF4 expression. Data shown as Log 2 (fold change), n = 3 (HIF1α), 5 (HIF2α) biological donors. (F) KLF4 and KLF5 expression in organoid scRNA-seq dataset (as described in ). (G) KLF4 and KLF5 expression in epithelial cells of the human fetal lung atlas. (H) Immunostaining of 10 pcw human fetal lung section showing KLF4 and TP63 expression. Arrows indicate KLF4 + TP63 + cells. Scale bars = 100 µm. RT-qPCR gene expression was normalised to ACTB . Statistical test: two-way ANOVA with Bonferroni’s multiple comparisons test. Significance levels: *p < 0.05, **p < 0.01.

Article Snippet: For mutated HIF1α and HIF2α overexpression, the HIF1A and HIF2A CDS were cloned from plasmids gifted from William Kaelin (Addgene, #87261, #25956) and inserted into Tet-ON vectors with EF1a-TagRFP-2A-tet3G., For CRISPRi, the gRNA sequences targeting HIF1A , HIF2A , KLF4 , KLF5 were selected from published dataset and inserted into U6-gRNA-EF1a-EGFP-CAAX lentiviral vectors (Addgene, #167936)., For targeted DamID, the wild-type HIF1A and HIF2A CDS were inserted into DamID vectors with SFFV-mNeonGreen as upstream open reading frame.

Techniques: Expressing, RNA Sequencing, Knockdown, Over Expression, Immunostaining, Quantitative RT-PCR, Gene Expression